Enhanced e-poly-L-lysine production by inducing double antibiotic-resistant mutations in Streptomyces albulus
Abstract e-Poly-L-lysine (e-PL), as a food additive, has been widely used in many countries. However, its pro- duction still needs to be improved. We successfully enhanced e-PL production of Streptomyces albulus FEEL-1 by introducing mutations related to antibiotics, such as streptomycin, gentamicin, and rifampin. Single- and dou- ble-resistant mutants (S-88 and SG-31) were finally screened with the improved e-PL productions of 2.81 and 3.83 g/L, 1.75- to 2.39-fold compared with that of initial strain FEEL-1. Then, the performances of mutants S-88 and SG-31 were compared with the parent strain FEEL-1 in a 5-L bioreactor under the optimal condition for e-PL production. After 174-h fed-batch fermentation, the e-PL production and productivity of hyper-strain SG-31 reached the maximum of 59.50 g/L and 8.21 g/L/day, respectively, which was 138 and 105% higher than that of FEEL-1. Analysis of streptomycin-resistant mutants demonstrated that a point mutation occurred in rpsL gene (encoding the ribosomal protein S12). These single and double mutants displayed remarkable increases of the activities and tran- scriptional levels of key enzymes in e-PL biosynthesis pathway, which may be responsible for the enhanced mycelia viability, respiratory activity, and e-PL produc- tions of SG-31. These results showed that the new breeding method, called ribosome engineering, could be a novel and effective breeding strategy for the evolution of e-PL-pro- ducing strains.
Introduction
e-Poly-L-Lysine (e-PL) is a natural homopolymer and characterized as a novel peptide. It consists of 25–35 L- lysine residues linked between a-carboxyl and e-amino groups [1, 2]. Due to its high antimicrobial activity, water solubility, biodegradability, and edibility, e-PL has been widely used as a food preservative in many countries, such as Japan, Korea, the United States, and China [3]. As the global demand for e-PL is strikingly increasing, the market prospect of e-PL is considered bright and promising [4].The e-PL productivities in wild-type strains are low. Since the first e-PL-producing strain Streptomyces albulus 346 was isolated in 1977 [5], many strains, such as Ki- tasatospora sp. MY 5–36, Streptomyces albulus NK660, Streptomyces albulus PD-1, and Streptomyces griseofuscus, were obtained for further study. Their e-PL productions in fed-batch fermentation were only 22, 4.2, 21.7, and 7.5 g/ L, respectively [6–9]. Nowadays, many efforts have been made for efficiently screening the industrial high-produc- ing strains. The most successful trail was made in 1998, when an L-lysine analog, S-(2-aminoethyl)-L-cysteine (AEC), was used as the selective marker to enhance the production of e-PL [10]. A hyper strain, Streptomyces albulus 11011A, was ultimately screened with significantly higher e-PL production (2.11 g/L) and aspartokinase (ASK) activity in shake flask test. Using a two-stage pH control strategy [11], this strain accumulated 48.3-g/L e-PL after 192-h cultivation in 5-L bioreactor, tenfold high compared to the initial strain. Ren et al. developed an integrated pH-shock strategy for promoting e-PL produc- tion. After 192 h of fed-batch fermentation, the maximum e-PL production and productivity reached 54.70 g/L and
6.84 g/L/day, respectively, which were 52.50% higher than those of control without pH shock [12]. Recently, modern metabolic engineering breeding technology has been applied in e-PL production promotion. Xu et al. established a genetic system to integrate Vitreoscilla hemoglobin (VHb) gene into the chromosome of S. albulus PD-1 to improve the e-PL biosynthesis (from 22.7 to 34.2 g/L) in fed-batch fermentation [13]. Gu et al. inserted heterologous VHb gene (vgb) and SAM synthetase gene (metK) into the
S. albulus NK660 chromosome, and finally increased both biomass (1.14-fold) and e-PL production (1.27-fold) in S. albulus NK660 [14]. However, there’s still some room for improvement of e-PL production.
In our lab, Li et al. iso- lated a series of wild Streptomyces spp. (Streptomyces padanus, Streptomyces griseofuscus, Streptomyces graminearus, Streptomyces hygroscopicus, and Strepto- myces albulus) to produce e-PL, then, interspecific hybridization was subsequently used to promote the pro- duction. At last, a hyper-strain (Streptomyces albulus FEEL-1) was obtained and used as the initial strain in this study [15]. Zhou et al. successfully enhanced e-PL pro- duction of Streptomyces albulus M-Z18 (from 1.80 to 3.11 g/L in shake flask) using e-PL itself as screening marker to weaken self-inhibition [16]. However, the above studies were inefficient and expensive.
We previously reported that certain unknown mutation related to streptomycin resistance brought about the striking e-PL production enhancement (from 1.74 to 2.91 g/L in shake flask) in S. albulus FEEL-1 [17]. Recently, we dis- covered that acquiring resistance to gentamicin could also improve the ability to produce e-PL (unpublished). These results indicated that there were other methods for the sig- nificant improvement of e-PL productivity. In this study, we first focused on obtaining a series of high-producing strains characterized by acquisition of single or double drug resis- tances. Subsequently, properties in the fermentation behavior of the mutant SG-31 were detected for improving the e-PL fermentation level. Moreover, e-PL synthetic pathways of initial strain FEEL-1 and the mutants were compared for further understanding of mechanism of cell growth and e-PL synthesis regulation. Some differences in physiological aspects between the mutants SG-31 and FEEL-1 were also described. Above all, ribosome engi- neering can be a remarkably effective tool for breeding hyper-yield industrial e-PL producing strains. To the best of our knowledge, this is the first attempt on evolution of e-PL producing strain by inducing combined drug-resistant mutations.
The initial strain FEEL-1 was described before [15]. Mutants with streptomycin resistance (strr), gentamicin resistance (genr) or rifampin resistance (rifr) were screened from colonies that grew on BTN agar plate containing various concentrations of the above antibiotics after an 8–10 days incubation at 30 °C.MIC was defined as the lowest concentration of an antibiotic that totally inhibited spores’ growth after incu- bation on BTN plate at 30 °C for 72 h. The MIC values of streptomycin (str), gentamicin (gen), and rifampin (rif) were listed in Table 2. Spore suspensions of all strains were stored at -80 °C.Solid medium BTN was described in previous studies [18, 19]. YH medium was used as the seed and product fermentation medium in this study. It comprised 30 g/L glucose, 5 g/L (NH4)2SO4, 8 g/L yeast extract, 2 g/L MgSO4·7H2O, 2 g/L KH2PO4, 0.04 g/L FeSO4, and 0.03 g/L ZnSO4. The pH was adjusted to 7.2 before autoclaving.First, spores’ suspension of FEEL-1 was treated by atmo- spheric and room temperature plasma (ARTP) mutagene- sis, whose detail procedure was described previously [17]. After ARTP mutagenesis, the treated spores were divided into three parts and spread on BTN agar plates containing 10 MIC of str (30 lg/mL), gen (10 lg/mL), and rif (2 lg/ mL), respectively, and incubated at 30 °C to obtain single drug-resistant mutants. After cultivating for 8-10 days, mutants with abundant spores were picked out for fer- mentation assays, and high-producing mutants were uti- lized as the starting strains to construct double-resistant mutants. In second round of screening, gradient plate was utilized to introduce double drug-resistant mutations into S. albulus. Spores’ suspensions (108 CFU) of the hyper-yield strains were collected by centrifugation, washed with aseptic water, and dispersed for 2 min in a sonic bath before inoculating on BTN agar gradient plate at 30 °C.
Total genomic DNAs of FEEL-1 and its derivates were extracted and purified by use of nucleic acid purification kit as described before [17]. The qualities of genomic DNAs were assessed on a 1% agar gel stained by gold view (Takara).To amplify rpsL gene from S. albulus, the synthetic oligonucleotide primers designed and used: P1 (forward 5′ GTGCCTACGATCCAGCAGCT 3′) and P2 (reverse 5′ TTACTTCTCCTTCTTGGCGCC3′). PCR assay was per- formed using ExTaq (Takara) on the basis of the manu- facturer’s instructions under the following conditions: denaturation at 96 °C for 2 min, 30 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min. The purified PCR products were sequenced by Shanghai Sangon Com- pany (Shanghai, China) and the data were analyzed and aligned by DNAMAN 6.0. The amplified rplF of the genr mutants and partial rpoB genes’ fragment (nucleotides 500–1200) of the rifr mutants were also obtained by PCR. The oligonucleotide primers of rplF and rpoB were sepa- rately designed as P3 (forward 5′ ATGTCGCGCATCGG CAAGC 3′) and P4 (reverse 5′ TTACTTACCCGCCTTTC CGACCTTG 3′), P5 (forward 5’TTGGCCGCCTCGCGCA ATG 3′) and P6 (forward 5′ TCAGACCTCTTCGACGCTGCTCG 3′). All primers were designed according to the sequence of S. albulus M-Z18, an e-PL-producing strain preserved in our lab [12, 16]. The assays of PCR and DNA sequencing were performed under the same conditions as those for the rpsL gene e-PL productivity (g/L/day) and qp (d-1) were calculated to determine the optimal condition for SG-31 in 5-L biore- actor by the following formula: e-PL productivity = DP = Pt2 — Pt1 colonies in primary screening were selected by subculti- vation and production assay in YH fermentation medium. All fermentation tests were performed in three independent shake flasks.
To further verify fermentation performance in a 5-L fermenter, two loops of spores of the high-producing mutants were inoculated into 500 mL shake flasks con- taining 80 mL YH medium. After 30-h cultivation, 240 mL of pre-cultured seed was transferred to a 5-L fermenter containing 3.2-L aseptic fermentation medium (initial pH 6.8) and incubated at 30 °C. With pH naturally decreased during the fermentation, NH3·H2O solution was added automatically and maintained the desired levels. The glu- cose concentration was maintained below 10 g/L by auto- matically pulsed the sterile 85% (w/v) glucose solution with a peristaltic pump into the culture medium. Residual NH3-N was maintained at 0.2–0.5 g/L by the addition of an aseptic (NH4)2SO4 solution at the concentration of 600 g/L.
The cell-free crude enzymes’ solution was obtained as described by Chen et al. [20]. Enzyme activities of hex- okinase (HK), glucose-6-phosphate (G6PDH2), phospho- enol pyruvate carboxylase (PEPC), pyruvate kinase (PK), aspartokinase (ASK), citrate synthetase (CS), isocitrate dehydrogenase (ICDH), aspartate aminotransferase (AAT), and e-PL synthetase (PLS) were evaluated by utilizing the method described previously by Morris et al., Xia et al., Xu et al. and Zeng et al., respectively [21–24]. All the enzyme activity assays were conducted in triplicate. Protein con- centration was determined according to the Bradford method [25]. All the chemicals, including coenzymes, buffers, and substrates, were bought from Sigma-Aldrich, St. Louis, USA.As the fermentation time reached 144 h (stationary phase) in 5-L fermenter, cell samples of S. albulus FEEL-1, S. albulus S-88, and S. albulus SG-31 were separately col-Fermentation evaluation in shake flask was conducted in two steps: In primary screening, three loops’ spores were inoculated in a 250-mL Erlenmeyer flask containing 40-mL seed medium for 96 h. In secondary screening, hyper-yield lected, and their bacterial RNAs were extracted from the mycelia by utilizing a MiniBEST Universal RNA Extrac- tion Kit. Spectrophotometer and gel electrophoresis were used to determine the quality and quantity of RNAs. Assays of reverse transcription reactions were performed with a Prime Script RT Reagent Kit. Transcription profiles of gene pepc, ask, pls, cs, aat, and hrdD were undertaken by qRT-PCR with Dongsheng qRT-PCR kit mixing 2 9 SYBR Green Mix (8.5 lL), forward primer (5 lM),reverse primer (5 lM), RNase-free H2O (6.4 lL), and cDNA (1.25 lL); a final volume of 17 lL was prepared by adding RNase-free H2O. The amplification was performed in a Cfx96 Real-Time PCR system. The conditions of qRT- PCR were: 50 °C for 2 min, 95 °C for 10 min, followed by 40 two-temperature cycles (95 °C for 15 s and 60 °C for 1 min). All of these experiments were done in triplicate using RNA samples extracted from three independent cultures. The qRT-PCR results’ analyses were subjected to 2-44Ct method for relative quantification with 16S rRNA as the endogenous control gene. All primers used were listed in Table 1, and they were designed on the basis of the genome sequence of S. albulus M-Z18. All procedures were conducted at 0-4 °C.
To determine the respiratory activity of Streptomyces, 5-cyano-2, 3-ditolyl-tetrazolium chloride (CTC) stain was utilized in this study. CTC is non-fluorescing and soluble, and it can be adsorbed and reduced into an insoluble red- fluorescent substance (CTC formazan) by respiring cells via the electron transport chain and accumulate in the cell [26]. The fluorescence intensity shows a positive corre- lation with the respiratory activity. Biomass samples of initial strain FEEL-1 and mutant SG-31 were collected at 18, 36, and 48 h from shake flasks, respectively, then they were centrifuged, washed twice, and re-suspended with saline (0.9% NaCl). The process of CTC staining was conducted as described by Ren et al. [12], and the stained samples were deposited on a clean slider and observed under a Leica confocal laser-scanning microscope (TCS- SP8, Leica Microsystems, Wetzlar, Germany) at the excitation wavelength of 488 nm and emission wave- length from 620 to 640 nm. A great numbers of images were analyzed in at least three independent culture analyses.The LIVE/DEAD Bac-Light Bacterial Viability Kit L-13152 (Invitrogen detection technologies, California, USA), which contains two nucleic acid staining dyes, SYTO 9 and propidium iodide (PI), was used to evaluate cultured mycelia viability. SYTO9 is a green fluorescent stain which penetrates both cells with intact membranes and cells and damaged cells, but PI only enters dead cells with damaged membranes. Whereas, SYTO 9 can be dis- placed by PI in dead cells because of its lower affinity for the nucleic acids. Thus, bacteria with intact cell membranes appear fluorescent green, while bacteria with damaged membranes appear red [27]. The process of staining was conducted as described preciously [28, 29], and the stained samples were deposited on a clean slider and observed under a Leica confocal laser-scanning microscope (TCS- SP8, Leica Microsystems, Wetzlar, Germany) at the exci- tation wavelength of 488 and 568 nm and observed at emission wavelengths of 530 nm (green) and 630 nm (red), respectively. Plenty of images were analyzed in at least three independent culture analyses.
The culture broth in shake flask or 5-L fermenter was sampled and centrifuged (4500 g, 10 min). The biomass was measured gravimetrically by filtering the sediment, washing twice with distilled water and drying at 100 °C until constant weight. The supernatant was utilized for the determination of the concentrations of glucose and e-PL. Glucose concentration was detected by a biosensor ana- lyzer SBA-40D (Shandong Academy of Sciences) [18], and e-PL concentration was determined as the description of Itzhaki [30] productivities, genr mutants displayed only low levels of resistance (threefold MIC) while the strr mutants displayed either a low or high level of resistance (twofold to tenfold MIC). Moreover, strr and genr mutants demonstrated higher e-PL productivities than rifr mutants. This result may due to rifr mutants grew somewhat more slowly and produced less aerial mycelia and spores, which contributed to the decline of propagating capacity and production stability. As a consequence, only strr mutants and genr mutants were picked out for the subsequent round of breeding. The above results indicated that str and gen are efficient screening markers for obtaining e-PL high-producing strains. Double-resistant isolates were constructed through generating spontaneous mutations in strr mutant S-88 and genr mutant G-59 (Table 2), and the breeding procedure was demonstrated in Fig. 1. As a result, a range of double- resistant mutants was finally obtained. Four mutants, SG- 31, SR-64, GS-12, and GR-40 were outstanding among others. Their highest e-PL productions reached 3.83, 3.54, 3.71, and 3.65 g/L, respectively, which were 2.39-, 2.21-, 2.32-, and 2.28-fold compared with that of initial strain FEEL-1. Moreover, the frequency of double mutants pro- ducing a greater amount of e-PL was as high as 14–20%. These results indicated that the combinations of drug-re- sistant mutations, strr + genr, strr + rifr, and genr + rifr, are effective for increasing e-PL productions. Representa- tive strains are listed in Table 2. Interestingly, in this round of breeding, rif was proved to be an effective screening marker for the improvement of e-PL production.
In 1996, Shima et al. first found a dramatic activation of antibiotic production by a certain ribosomal mutation (in rpsL gene encoding the ribosomal protein S12), which conferred to strr in Streptomyces lividans and Streptomyces coelicolor A3(2) [31]. This result indicated that bacterial gene expression may be changed dramatically by modu- lating the ribosomal proteins or rRNA, eventually leading to activation of inactive (silent) genes. Thus, ‘‘ribosome engineering’’ was applied for a rational approach to fully elicit the bacterial abilities [32]. According to Ochi’s study, one of the most conventional ways to modulate the ribo- some is the introduction of mutations conferring resistance to drugs that attack the ribosome. Such drugs include streptomycin, gentamicin, paromomycin, thiostrepton, lin- comycin, spectinomycin, and neomycin. The drug-resistant mutants frequently possess a point mutation or a deletion mutation within a ribosomal component (ribosomal protein or rRNA), which finally resulted in the rapid improvement of strains. For example, some mutation in ribosomal pro- tein S12 (encoded by rpsL gene) brought about significant increases in antibiotic productivities, 5- to 50-fold greater than those of wild strains [33]. Moreover, acquisition of resistance to other aminoglycoside antibiotics (gentamicin and Geneticin) was found confering the ability to produce actinorhodin in S. lividan 66, which normally does not produce actinorhodin [34, 35]. Genr-aided mutations have also been proved to generate the improvement of the actinorhodin, streptomycin, and pyrrolnitrin productions of Streptomyces lividans, Streptomyces antibioticus 3720, and Pseudomonas. pyrrocinia 2327, respectively [34]. What’s more, mutations in rplF (coding for ribosomal protein L6) and 16 s rRNA will result in genr and the improvement of translational accuracy and translation efficiency, leading to the promotion of antibiotic production. Some successful trials were also made to improve antibiotic-producing strains by inducing rif-related mutations (rpoB gene, cod- ing RNA polymerase) [36].
Here, we sequenced and compared the rpsL, rplF, and rpoB genes of both initial strain (FEEL-1) and drug-resis- tant (single and double) strains. As summarized in Table 2, mutant S-88, with 30-lg/mL level of strr, contained a mutation in rpsL gene, where the changed nucleotide (from A to G) was at position 323, resulting in an alteration of Lys-108 to Arg. Whereas, mutants with low levels of strr, such as S-62, demonstrated no mutation in the rpsL gene. It is known that certain mutations in the 16S rRNAs or the rpsD gene, which encodes the ribosomal S4 protein, have been known to confer strr [32], but no mutation was found in either. Sequencing data also revealed that none of the genr mutants (single or double) have a mutation in the rplF gene. Moreover, we focused on a so-called rif domain (nucleotides 500–1200) as described previously in E. coli when sequencing the rpoB gene [35]. However, we failed to find a mutation in this region too, and we inferred that there perhaps is a mutation in the other part of the rpoB gene not sequenced. To our knowledge, ribosome engi- neering was always utilized on wild strains, and it has never been used to improve the hyper-yield strain. In our study, we utilized ribosome engineering on a high-pro- ducing strain FEEL-1 with two modifications: (1)combining the drug-resistant mutation with mutagenesis to increase the genetic diversity; (2) designing gradient plate to improve efficiency.
Previous studies described that pH was one of the most significant factors in the process of e-PL fermentation [11, 12]. Thus, 5-L scale assays were designed to verify the good fermentation performances of drug-resistant mutants. First, five different pH values (3.5, 3.8, 4.0, 4.2, 4.5) were selected to evaluate the most appropriate pH for mutant SG-31 to produce e-PL. The result demonstrated that DCW value (Fig. 2a) of SG-31 has a positive correlation with the pH level. Whereas, e-PL production and e-PL productivity (Fig. 2b, c) reached the maximum of 8.8 g/L and 4.06 g/L/ d at pH 4.2 (not 4.5). Moreover, the average e-PL forma- tion rates (qp) at different pH level were calculated to further confirm the optimal pH for e-PL fermentation. The result showed at pH 4.2, the average e-PL formation rate (0.246 d-1) was higher compared to that at other pH values (Fig. 2d). Considering the parameters obtained above, we suggested pH 4.2 as the optimal pH to produce e-PL.
Assay of fed-batch fermentations was conducted to value the fermentation performances among the initial strain FEEL-1, single drug-resistant mutant S-88 (strr) and double drug-resistant mutant SG-31 (strr + genr). The time courses of these fermentations were displayed in Fig. 3. The pH decline trends of these three strains showed no obvious differences (Fig. 3a). All pHs were naturally dropped to the optimal pH (pH 4.2) for e-PL production in about 18 h. However, the glucose consumption rate of SG- 31 was expedited and obviously outstripped that of S-88 and FEEL-1 (Fig. 3b). As anticipated, after only 174-h fed- batch cultivation, double drug-resistant mutant SG-31 and single drug-resistant mutant S-88 accumulated high e-PL concentration of 59.5 and 46.1 g/L, 2.38- and 1.84-fold compared to initial strain FEEL-1 (25 g/L), respectively. Interestingly, cell growth rates and DCWs of S-88 and SG- 31 were a little lower than that of FEEL-1 during the fer- mentation (Fig. 3c), which was opposite to our previous conclusion that the more DCW, the higher e-PL production [16]. The reduced DCW also conferred to the enhancement of average e-PL formation rate, increasing from 0.166/day (FEEL-1) to 0.270/day (S-88) and 0.392/day (SG-31). For all we know, it is the first study concerning e-PL produc- tion and exceeding the reported highest e-PL production of 48.3 g/L without any special fermentation control strategy [11, 20, 37].
To elucidate mechanisms of the improved e-PL yield, we sequenced the genomic DNA of S. albulus M-Z18 (another initial e-PL producing strain in our lab), and finally the main metabolic pathway for e-PL biosynthesis was con- structed according to gene annotation (Fig. 4). We found that e-PL was synthesized via glycolytic pathway (EMP), pentose phosphate pathway (PPP), tricarboxylic acid (TCA) cycle, and L-lysine synthetic pathway (DAP), while HK, G6PDH, PK, PEPC, CS, ICDH, AAT, ASK, and PLS are considered to be the key enzymes according to the literature [22–24]. Then, key enzyme activities of FEEL-1,Main metabolic pathway for e-PL biosynthesis in S. albulus. G-6-P glucose-6-phosphate, F-6-P fructose-6-phosphate, PEP phos- phoenolpyruvate, PYR pyruvate, AcCoA Acetyl-CoA, Cit citric acid, Iso-Cit isocitric acid, a-KG a-oxoglutarate, Asp aspartate, Lys L- lysine, e-PL e-poly-lysine, Ri-5-P ribulose-5-phosphate, E-4-P ery- throse-4-phosphate S-88, and SG-31 were evaluated at 144 h (fermentation stationary phase) of fed-batch fermentation and expressed in Table 3.We found that after single strr screening, the key enzyme activities of S-88 were obviously improved from 31.6 to 106%. This result was consistent with the double drug-resistant mutant SG-31, whose key enzyme activities were further promoted from 59.9 to 184%. The boost of key enzyme activities is believed to be responsible for the rapider consume of glucose (Fig. 3b) and the stronger fluxes of EMP, PPP, TCA cycle, and DAP in the S-88 and SG-31. Moreover, the PLS activities were also increased, which directly enhanced the mutants’ abilities of synthe- sizing e-PL. Previous reports showed that only a part of synthetic pathway (DAP) was increased in e-PL high- producing F4-22 [16]. However, our study demonstrated that metabolic fluxes of the EMP, PPP, TCA cycle, and DAP of mutants were somewhat increased. This result indicated that ribosome engineering can not only enhance the e-PL production, but also improve the key enzyme activities of the drug-aided mutants.
Transcription levels of pepc, ask, pls, cs, aat, and hrdD in the mutants S-88 and SG-31 were also compared to those of initial strain FEEL-1 at 144 h of fermentation. As shown in Fig. 5, transcriptional levels of gene pepc, ask, pls, and cs were increased, which may be responsible for the increased activities of PEPC, ASK, PLS, and CS. In addition, the transcription levels of gene hrdD in S-88 and SG-31 were 1.45- and 2.80-fold compared to that of FEEL-1. It is known that HrdD (sigma factor, a transcriptional activator showing the most sensitive response to pH) is able to specifically bind to the pls-gene promoter, regulate the pls expression, and initiate e-PL synthesis [38]. Thus, we considered that the improved transcriptional level of hrdD is responsible for the enhancement of pls transcrip- tion level and e-PL biosynthesis. In sum, we believe that introducing combined drug-resistant mutations makes sig- nificant contribution to the e-PL production, key enzyme activities, and transcription levels of key genes.
Mycelia of strain FEEL-1 and SG-31 were collected from shake flask culture broth and stained with SYTO9 and PI, and then mycelia viability was analyzed under confocal microscopy and displayed in Fig. 6. At the preliminary stage of fermentation (18 h), dead cells began to appear in the pellets of FEEL-1. Subsequently, pH decline to 3.0 at 36 h, which directly lead to the death of mycelia in pellets. With the decrease of pH value, the inner core of dead mycelia grew at a relatively fast rate. At the time of 48 h, the inner cores of dead mycelia of mutant SG-31 were apparently smaller than those of FEEL-1. Moreover, we found that the inner core of dead mycelia appeared later in mutant SG-31, which means the mycelia viability of SG-31 was higher than that of FEEL-1 during the fermentation.Mycelia respiratory activity was determined by CTC staining throughout the fermentation process. CTC for- mazan presented a red fluorescence when excited by blue light, and it has accumulated inside samples with different fluorescence intensity during the fermentation. We found that during the fermentation, mycelia respiratory activities of both FEEL-1 and SG-31 decreased, while SG-31 showed a higher mycelia respiratory activity than FEEL-1 (Fig. 7). These results were consistent with the result of viability staining. So we can conclude that the viability of SG-31 was significantly higher than that of FEEL-1, which further influenced the metabolic activity and e-PL productivity. Moreover, we speculated that the improved mycelia via- bility and respiratory activity may attribute to the promoted key enzyme activities of strain SG-31 in shake flask fer- mentation (data not show), which increased the flux of TCA cycle. In conclusion, mycelia viability was increased in drug-resistant mutants during the process of ribosome engineering.
Conclusion
Our method is characterized by constructing combined resistant strains with ribosome engineering and efficiently contributing to the promotion of e-PL production. Through this strategy, a double drug-resistant mutant, SG-31 (strr + genr), was finally obtained with e-PL production and productivity of 59.5 g/L and 8.21 g/L/day, respec- tively, after 174 h fed-batch fermentation, 2.38- and 2.05- fold compared to those of the parent strain under the same culture condition. However, the changes in genomic DNAs behind ribosome engineering still needs to be further studied. Moreover, we suppose that making some other trials, such as optimization of fermentation strategy and key gene modification, may further significantly give rise to yield improvement. The obtained results may be effec- tive not only for e-PL large-scale production but also for certain key enzyme production linked with secondary metabolism [35].Acknowledgements This work was supported by the Cooperation Project of Jiangsu Province among Industries, Universities and Institutes (BY2016022-25), the Innovation Plan of Jiangsu Province (KYLX15_1146), National Natural Science Foundation of China (21376106), the Fundamental Research Funds for the Central Universities (JUSRP51504), the Open ε-poly-L-lysine Project Program of the Key Laboratory of Industrial Biotechnology, Ministry of Education, China (KLIBKF201302), the Jiangsu Province Collaborative Innovation Center for Advanced Industrial Fermentation Industry Development Program.